Regular expressions are used to match patterns in strings. Strings are sequences of characters and regular expressions excel at both finding strings through patterns and enforcing patterns on strings. If you need to find anything beyond exact character strings with or without general case insensitivity then it is time to consider leaving behind standard tools for finding text and embracing regular expressions.
This walkthrough is meant to be used as a loose script and general resource to be shared as part of a standalone, 120-minute workshop as part of a regular workshop series offered by Prairies DRI.
- Overview
- Setup
- Search
- Extract
- Report
- Modify
It saves tons of time and make your life much easier when dealing with "big data".
([0-9.]{1,}) to ([0-9.]{1,})\)
change to
\1-\2)
We can validate email in Excel table with Visual Basics of Application (VBA).
These are three things you need to know to be successful with regular expressions
- Your data.
- How "other people" will mess up what you expect about your data.
- Where to get help—and double check!—reading and writing regular expressions.
We'll be using both https://regex101.com/ and https://colab.research.google.com/ so each participant should have each open in a separate tab.
Everyone should open browser and point it to https://regex101.com/ and https://colab.research.google.com/.
Our focus for examples will be Canadian postal codes. These are a fairly straight forward pattern that could have a lot of alternatives to control for. No need to load in a set of these, we'll build our dataset as we go.
Type "A1A1A1" into the TEXT STRING
box. In the REGULAR EXPRESSION
box and we'll begin building a regular expression to find or enforce Canadian postal codes. Type:
A1A1A1
As you are typing you'll notice that different parts of the sample text are highlighted in blue. If you type something other than is in the TEST STRING
box then the highlighting will disappear, this includes typing too many characters. This is the regex engine parsing away as you enter the search expression. When complete you'll see the number of matches, steps, and time taken to carryout the search. In this case it should look something like 1 match (7 steps, 1.0ms)
. Even with a long text the search search is pretty fast, much faster than you or I scrolling through the text to find a text string.
So, it can match exactly what we type. Can it ignore things that do not mach? Type something else:
hello
Note that it doesn't matter where the hello
is as long as it doesn't break up the original string.
What about a different postal code? Type your own postal code into the TEST STRING
box.
M5W1E6
It won't detect this new postal code. Why? Because we've been very specific, providing a regular expression that will match A1A1A1
exactly. We can see this by opening the EXPLANATION PANEL to the right of the REGULAR EXPRESSION box.
Which postal code is from Alberta?
V5P 0L9
T4X 0A5
V2C 1E3
V5C 1L3
T5A 0A1
X4G 5D6
Click to see the answer!
T
Which postal code is from Alberta?
V5P 0L9
T4X 0A5
V2C 1E3
V5C 1L3
T5A 0A1
X4G 5D6
V5C 1TC
How to specify the "T" in the start?
^T
Other anchors:
$
\b
Example 1. Postcode:
A1A1A1
Code:
[A-Z][0-9][A-Z][0-9][A-Z][0-9]
Example 2. Grade:
Mickey Mouse A
Donald Duck B
Peppa Pig C
Paw Patrol A
Who got B or higher?
\s(A|B)\b
Daily snowfall amount (mm):
Sun 4.5
Mon 7.3
Tue 9.4
Wed 7.9
Thu 2.7
Fri 3.4
Sat 5.2
Which day(s) in this week have more than 5 mm snowfall?
[5-9]\.[0-9]
"." here is a special character in regex syntax, which means any character. However, with "" in front, it represents itself "." in this case.
Annual snowfall amount (cm):
Washington 1640.0
California 1045.0
New York 544.0
Texas 51.0
Georgia 9.7
Florida 0.2
Hawaii 0.0
Which state(s) have at least 10 cm snowfall?
[0-9]{2,4}\.[0-9]
Postcode:
A1A 1A1
A1A1A1
Code:
[A-Z][0-9][A-Z]\s?[0-9][A-Z][0-9]
Find all cities from USA:
Edmonton, Canada
New York City, USA
Washington, United States of America
Calgary, CA
Toronto, Canada
Vancouver, CA
Los Angeles, U.S.
Chicago, U.S.A
Seattle, US
Click to see the answer!
,\s(U\.?S\.?A?|United States)\b
. # any character except new line
\d # a digit
[36] # 3 or 6
[3-6] # 3 or 4 or 5 or 6
[^3-6] # anything not 3, 4, 5, or 6
\D # a non-digit
\w # a word character: letter or digit or _
\W # a non-word character
\t # tab
\n # new line
+ # at least 1 repeat, same as {1,}
? # 0 or 1 repeat, same as {,1}
* # any number of repetitions. Same as {,}
\s # a whitespace
\S # a non-whitespace character
| # or
\. # to match a dot "."
^ # start of the string
$ # end of the string
#1 It's very important to understand your data.
#2 You may want to do multiple testing before applying your code. Validate the output after each step.
#3 Make a good plan when generating the data. Think about how to make it consistent, straightforward, reproducible and easy to process.
We can "group" the patterns and "capture" the matches.
Print out the cities in US:
Edmonton, Canada
New York City, US
Washington, US
Calgary, CA
Toronto, Canada
Vancouver, CA
Los Angeles, US
Chicago, US
Seattle, US
Code:
(.*),\sUS\b
Get the first name and last name
John Michael Smith
Emma Johnson
Tony H. Brown
Code:
^(\w{1,}) .* (\w{0,})$
Get the students' names, grades and courses:
John got A in Maths, B in Arts, and C in Physics.
Emma got C in English, A in Chemistry, and B in History.
Tony got B in French, B in Maths, and D in Arts.
Click to see the answer!
^(\w{1,}) got (\w) in (\w+), (\w) in (\w+), and (\w) in (\w+)
Open https://colab.research.google.com/ in your browser, login with your google account.
import re
input = "University of Alberta"
output = re.search(r"of", input)
What does it report?
print(output)
print(output.start())
print(output.end())
import re
cities = ["Vancouver BC", "Calgary AB", "Edmonton Alberta", "Toronto ON"]
for city in cities:
output=re.search(r"(AB|Alberta)", city)
if output:
print(city+" is in Alberta")
else:
print(city+" is not in Alberta")
Get the city name and the province: "Vancouver BC", "Calgary AB", "Edmonton Alberta", "Toronto ON"
import re
cities = ["Vancouver BC", "Calgary AB", "Edmonton Alberta", "Toronto ON"]
for city in cities:
output=re.search(r"(\w{1,}) (\w{1,})", city)
print("City:" + output.group(1) + ", Province:" + output.group(2))
Get the students' names and their grades in Math:
John got A in Maths, B in Arts, and C in Physics.
Emma got C in English, A in Chemistry, and B in Maths.
Tony got B in French, B in Maths, and D in Arts.
You can start with:
import re
grades = ["John got A in Maths, B in Arts, and C in Physics.", "Emma got C in English, A in Chemistry, and B in Maths.", "Tony got B in French, B in Maths, and D in Arts."]
for grade in grades:
Fill the regular expression here. Click to see the answer!
output=re.search(r"^(\w{1,}) got.*(\w) in Maths", grade)
And then report by:
print(output.group(1) + "'s Math grade is "+output.group(2))
For the last example about students' grades in different courses, what if some students take 2 or 4 or more courses. For example:
John got A in Maths, B in Arts, A in chemistry, and C in Physics.
Emma got C in English, and B in History.
Tony got B in French, B in Maths, and D in Arts.
We need to use another function re.finditer to capture all matches.
import re
students = [
"John got A in Maths, B in Arts, A in chemistry, and C in Physics",
"Emma got C in English, A in Chemistry and B in History",
"Tony got B in French, and D in Arts"
]
for student in students:
get_name = re.search(r"^(\w+)", student)
print("Grades for Student: " + get_name.group(1))
all_matches = re.finditer(r"([ABCDF]) in (\w+)", student)
for match in all_matches:
course = match.group(2)
grade = match.group(1)
print(course + ":" + grade)
Change date format from 01/24/2025 to 2025-01-24
import re
input = "01/24/2025"
output = re.sub(r"(\d{2})\/(\d{2})\/(\d{4})", r"\3-\1-\2", input)
print(output)
import re
input_text = "The iPhone 16 features a 6.1-inch OLED display. It is 14.76 cm long, 7.16 cm high, and 0.78 cm deep."
pattern = r"(\d+(\.\d+)?) cm"
def convert_to_mm(match):
cm_value = float(match.group(1))
mm_value = round(cm_value * 10, 1)
return f"{mm_value} mm"
output_text = re.sub(pattern, convert_to_mm, input_text)
print(output_text)
Use the python regular expression to standardize the phone number:
Convert:
(604)123-1111
to:
604-123-1111
Change "pattern" and "replacement" below with your answers:
import re
re.sub(r"pattern", r"replacement", "(604)123-1111")
Fill the regular expression here. Click to see the answer!
re.sub(r"^\((\d{3})\)",r"\1-","(604)123-1111")
A start codon is the first codon in a messenger RNA (mRNA) transcript that is translated into a protein by a ribosome. The start codon is typically ATG, but can be TTG and GTG in E.coli. Use regular expression 101 to find all start codon in the following DNA sequence.
GATCTGACTAGACATCAGGCCCGGATGCAAC
- http://www.rexegg.com/
- http://www.regular-expressions.info/
- https://www.sitepoint.com/demystifying-regex-with-practical-examples/
- https://www.loggly.com/blog/regexes-the-bad-better-best/
- https://regex101.com/
- http://www.regexpal.com/ = http://www.regextester.com/
- http://regexr.com/
- http://myregexp.com/
Click here. Thank you!