Skip to content

julianeweller/MinsePIE

Repository files navigation

MinsePIE   🥧

To predict insertion rates, also check out the MinsePIE online tool on elixir.ut.ee/minsepie/.

Modelling insertion efficiency for Prime Insertion Experiments

Alt Text

Writing short sequences into the genome with prime eiditng faciliates protein tagging, correction of pathogenic deletions and many more exciting applications. We studied the features that influence insertion efficiency and built a model to predict insertion rates based on the insert sequence. This helps users to choose optimal contructs for DNA insertion with prime editing.

The provided model "MinsePIE.sav" was trained on 22974 events: a libary of 2,666 insert sequences up to 69 nt in length in four genomic sites (CLYBL, EMX1, FANCF, HEK3) in three human cell lines, using the PE2 prime editing system.

System requirements

If you encounter problems setting up the environment or packages, please check out the detailed description for installing the packages in the scripts folder.

Usage guide

The MinsePIE tools are constantly improving. Therefore, it is recommended to run clone the github repository and update it frequently:

# clone
git clone https://github.com/julianeweller/MinsePIE.git
# update
git pull
# install MinsePIE: go into the folder with setup.py
pip install .

Here is an example on how to use minsepie in python:

import minsepie
minsepie.predict(['TGTCA'], pbs = 'CAGACTGAGCACG', ha = 'TGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCA', spacer = 'GGCCCAGACTGAGCACGTGA', mmr = 0, outdir = "./")

Python API

Prediction

minsepie.predict(insert, fasta = None, pbs = None, ha = None, spacer = None, halen = 15, pbslen = 13, spclen = 20, mmr = 0, inputmode = None, cellline = None, outdir = None, mean = None, std = None, model = None)

Predicts editing outcomes for insert sequences based on pegRNA features given individually or determined from fasta sequence. Provide either fasta (with optionally rttlen, pbslen, spclen) or pbs + rtt + spacer.

Parameter Type Description
insert list Insert sequences to be tested
fasta file Fasta file with target sequences
pbs str Primer binding site sequence for the pegRNA
ha str Homology arm for reverse transcriptase template covering the homology sequence. This does not include the new sequence to be inserted
spacer str pegRNA spacer
halen int Length of the RTT. Only needed if target site is provided as fasta.
pbslen int Length of the PBS. Only needed if target site is provided as fasta.
spclen int Length of the spacer. Only needed if target site is provided as fasta.
mmr int Mismatch repair proficiency of cell line. 0: MMR deficient. 1: MMR proficient
Inputmode “dna”, “protein”, or None Insert sequence can either be nucleotides or amino acids. If none, default is DNA.
cellline str, None Instead of providing the MMR status directly, cell line can be provided and MMR status is determined based on reference file.
outdir dir Output directory
mean int, None Expected mean editing rate for the prime editing screen used to scale the z-factor to an insertion rate.
std int, None Expected standard deviation for the prime editing screen used to scale the z-factor to an insertion rate.
model str, None Model used to predict editing efficiency.

Returns request as dataframe with features and prediction

Example:

predict([“TGTCA”], pbs = “CAGACTGAGCACG”, ha = “TGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCA”, spacer = “GGCCCAGACTGAGCACGTGA”, mmr = 0)

Reference

Prediction of prime editing insertion efficiencies using sequence features and DNA repair determinants
Jonas Koeppel, Juliane Weller, Elin Madli Peets, Ananth Pallaseni, Ivan Kuzmin, Uku Raudvere, Hedi Peterson, Fabio Giuseppe Liberante & Leopold Parts
Nat Biotechnol (2023)
doi: https://doi.org/10.1101/2021.11.10.468024

About

Modelling insertion efficiency for Prime Insertion Experiments

Topics

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Contributors 2

  •  
  •