Skip to content

Conversation

@fraser-combe
Copy link
Contributor

@fraser-combe fraser-combe commented Sep 20, 2024

This pull request adds a Dockerfile and accompanying README for Dorado version 0.8.0.

Dorado is a high-performance, open-source tool developed by Oxford Nanopore Technologies for basecalling Oxford Nanopore sequencing data. It supports both CPU and GPU acceleration, providing rapid and accurate basecalling of Fast5/Pod5 files.

Key features of this Docker image:

Dorado Version 0.8.0: Includes the latest stable release of Dorado.
Pre-downloaded Basecalling Models: All necessary basecalling models are downloaded during the build process and stored in /dorado_models.
Sample Pod5 Test File: A sample Pod5 file is included for testing purposes.
Internal Test Stage: The Dockerfile includes an internal test stage that runs during the build process to ensure Dorado is installed correctly and functioning as expected.
NVIDIA CUDA Support: Based on the NVIDIA CUDA 12.2.0 base image to enable GPU acceleration (requires an NVIDIA GPU and the NVIDIA Container Toolkit).

The README.md for Dorado 0.8.0 is longer than 30 lines because it includes detailed instructions and explanations necessary for users to effectively build, run, and test the Docker image. Given that Dorado utilizes GPU acceleration, it's important to provide comprehensive guidance.

Demonstration of GPU Functionality
I have tested the Dorado 0.8.0 Docker image on a GPU-enabled Linux machine to confirm that it utilizes GPU acceleration as intended.

System Details:

GPU Model: NVIDIA Tesla T4
Driver Version: 460.32.03
CUDA Version: 12.2
Operating System: Ubuntu 20.04

nvidia-smi Output:

Fri Sep 20 20:26:53 2024
+-----------------------------------------------------------------------------+
| NVIDIA-SMI 460.32.03    Driver Version: 460.32.03    CUDA Version: 12.2     |
|-------------------------------+----------------------+----------------------+
| GPU  Name        Persistence-M| Bus-Id        Disp.A | Volatile Uncorr. ECC |
| Fan  Temp  Perf  Pwr:Usage/Cap|         Memory-Usage | GPU-Util  Compute M. |
|===============================+======================+======================|
|   0  Tesla T4            Off  | 00000000:01:00.0 Off |                  Off |
| N/A   40C    P8     8W /  70W |      0MiB / 15109MiB |      0%      Default |
+-------------------------------+----------------------+----------------------+
  1. Dorado Basecalling Output:
==========
== CUDA ==
==========

CUDA Version 12.2.0

Container image Copyright (c)
2016-2023, NVIDIA CORPORATION & AFFILIATES. All rights reserved.

This container image and its contents are governed by the NVIDIA Deep Learning Container License.
By pulling and using the container, you accept the terms and conditions of this license:
https://developer.nvidia.com/ngc/nvidia-deep-learning-container-license

A copy of this license is made available in this container at /NGC-DL-CONTAINER-LICENSE for your convenience.

[2024-09-20 20:28:50.255] [info] Running: "basecaller" "/dorado_models/dna_r10.4.1_e8.2_260bps_sup@v3.5.2" "/usr/src/app/dna_r10.4.1_e8.2_260bps-FLO_PRO114-SQK_NBD114_96_260-4000.pod5" "--emit-moves"
[2024-09-20 20:28:50.375] [info] > Creating basecall pipeline
[2024-09-20 20:28:52.273] [warning] Unable to find chunk benchmarks for GPU "Tesla T4", model /dorado_models/dna_r10.4.1_e8.2_260bps_sup@v3.5.2 and chunk size 1440. Full benchmarking will run for this device, which may take some time.
[2024-09-20 20:29:08.590] [info] cuda:0 using chunk size 10000, batch size 256
[2024-09-20 20:29:10.402] [info] cuda:0 using chunk size 5000, batch size 640
[2024-09-20 20:29:15.202] [info] > Simplex reads basecalled: 1
[2024-09-20 20:29:15.202] [info] > Basecalled @ Samples/s: 8.841649e+02
[2024-09-20 20:29:15.202] [info] > Finished
  1. Sample SAM File Output:
    samtools view basecalled.sam
@HD	VN:1.6	SO:unknown
@SQ	SN:reference	LN:0
@PG	ID:dorado	PN:dorado	VN:0.8.0	CL:dorado basecaller /dorado_models/dna_r10.4.1_e8.2_260bps_sup@v3.5.2 /usr/src/app/dna_r10.4.1_e8.2_260bps-FLO_PRO114-SQK_NBD114_96_260-4000.pod5 --emit-moves
c4b111a0-90eb-436e-b6b1-cf14dee1fb93	4	*	0	0	*	*	0	0	TATGTCTCTGGTTCGGTTGGTCTTGCTAGACACAGGAAGGGGGCCAGGGTGTCAGAGAGCAGAAGATGGGGTGAGGAGTGGTGGGAGCCAGCGTGGAAGGTGTTGACTCTATGGTGACCTGGGTCCCCTCCTGCACCAAGTGGGGTGGCAGTGAGCAGGGTGACTGTCGTCTATGCT	`$$'(($##"##'+*((((*++,,--.4322236465329**3/BC>====CAAAAAEECDD5))));9;;BFKKIDHF>>>>>GA@BCEDA?999::IGEDDA@54//))))&&&''(((,23(CCDDGEDCEFDBCCABA@@CDDJKOKKHMGEEEFJHGCCABABBBBCDBCCDB`	qs:f:14.8748	du:f:0.512	ns:i:2048	ts:i:10	mx:i:1	ch:i:1	st:Z:2023-11-25T19:15:40.684+00:00	rn:i:1	fn:Z:dna_r10.4.1_e8.2_260bps-FLO_PRO114-SQK_NBD114_96_260-4000.pod5	sm:f:920.55	sd:f:179.67	sv:Z:quantile	dx:i:0	RG:Z:test_dna_r10.4.1_e8.2_260bps_sup@v3.5.2	mv:B:c,5,1,0,1,0,0,0,1,1,0,0,1,1,0,0,0,0,0,0,0,1,0,1,0,0,0,1,1,0,0,0,1,0,0,0,0,0,0,0,0,0,0,1,0,1,0,1,0,0,1,1,1,1,0,0,1,1,1,1,0,1,0,1,0,1,0,1,0,1,1,0,0,1,0,0,1,0,1,0,1,0,1,1,1,0,1,0,0,1,0,0,0,0,1,0,1,0,0,0,1,0,1,1,0,1,1,0,1,1,0,1,1,0,1,0,1,1,0,0,1,0,0,0,0,1,1,0,0,0,0,0,1,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,1,0,1,0,1,1,0,1,0,0,1,1,0,0,1,0,1,0,1,0,1,1,0,1,1,1,1,0,1,1,0,1,0,0,1,0,0,0,1,1,0,1,1,1,1,0,1,1,0,1,1,0,1,1,0,0,0,1,0,1,1,0,0,1,0,1,0,0,0,0,1,0,1,1,0,1,0,1,0,1,0,1,0,0,0,1,0,1,0,1,0,1,1,1,1,0,1,0,1,1,0,0,0,1,0,0,1,0,1,0,1,0,1,1,0,1,0,1,0,1,0,1,0,1,1,0,1,0,1,0,1,0,1,1,0,1,0,1,0,0,0,0,0,1,0,1,0,0,0,1,0,1,1,0,1,1,0,1,0,1,0,1,0,1,0

Pull Request (PR) checklist:

  • Include a description of what is in this pull request in this message.
  • The dockerfile successfully builds to a test target for the user creating the PR. (i.e. docker build --tag samtools:1.15test --target test docker-builds/samtools/1.15 )
  • Directory structure as name of the tool in lower case with special characters removed with a subdirectory of the version number (i.e. spades/3.12.0/Dockerfile)
    • (optional) All test files are located in same directory as the Dockerfile (i.e. shigatyper/2.0.1/test.sh)
  • Create a simple container-specific README.md in the same directory as the Dockerfile (i.e. spades/3.12.0/README.md)
    • If this README is longer than 30 lines, there is an explanation as to why more detail was needed
  • Dockerfile includes the recommended LABELS
  • Main README.md has been updated to include the tool and/or version of the dockerfile(s) in this PR
  • Program_Licenses.md contains the tool(s) used in this PR and has been updated for any missing

@kapsakcj kapsakcj self-requested a review September 20, 2024 18:59
@kapsakcj
Copy link
Collaborator

Nice work on this dockerfile 👍 OK the GitHub Actions runners don't have enough storage space to run the automated tests. That base image is pretty large which contributed to that. In lieu of the automated tests I've built the docker image locally to test it out. It builds successfully and the tests passes ✅

Requested changes:

/README.md:

  • add your github handle to the list of authors/maintainers if you'd like (optional, up to you)
  • add a new row in the table similar to the other docker images. Please keep it in alphabetical order.

/Program_licenses.md:

  • add a new row in the table similar to the other ones to link to ONT's license. Also keep this in alphabetical order

dorado/0.8.0/Dockerfile:

  • likely do not need build-essential since I don't see any compiling happening. please remove line 23
  • add ca-certificates to the apt-get install command as it's used by wget
  • add apt-get install --no-install-recommends option to prevent from installing unnecessary packages.
  • add && rm -rf /var/lib/apt/lists/* && apt-get autoclean to the end of the RUN layer thats starts on line 22. This will remove unnecessary stuff from apt. Please see other dockerfiles for examples, like this:
    rm -rf /var/lib/apt/lists/* && apt-get autoclean
  • move lines 41-44 down into the test stage somewhere. That way we don't have a POD5 file left in the docker image when we deploy it. The deployed image will only have the app stage included

dorado/0.8.0/README.md:

  • remove lines 32-38. I don't think this is necessary since we'll end up hosting the pre-built image on dockerhub and quay. We have documentation elsewhere in the repo on how to build a docker image (in addition to official docker docs)
  • update or delete line 24 since we're not going to include the test pod5 file in the final app stage.
  • it would be really helpful to list the models included in the docker image, so please show the output of this command in this README.md file. I know dorado has auto-model selection (which is awesome) but if users want to know exactly what's included they can look at this README.md
$ dorado download --list-yaml
[2024-09-20 21:10:30.520] [info] Running: "download" "--list-yaml"
modification models:
  - "dna_r9.4.1_e8_fast@v3.4_5mCG@v0.1"
  - "dna_r9.4.1_e8_hac@v3.3_5mCG@v0.1"
  - "dna_r9.4.1_e8_sup@v3.3_5mCG@v0.1"
  - "dna_r9.4.1_e8_fast@v3.4_5mCG_5hmCG@v0"
  - "dna_r9.4.1_e8_hac@v3.3_5mCG_5hmCG@v0"
  - "dna_r9.4.1_e8_sup@v3.3_5mCG_5hmCG@v0"
  - "dna_r10.4.1_e8.2_260bps_fast@v3.5.2_5mCG@v2"
  - "dna_r10.4.1_e8.2_260bps_hac@v3.5.2_5mCG@v2"
  - "dna_r10.4.1_e8.2_260bps_sup@v3.5.2_5mCG@v2"
  - "dna_r10.4.1_e8.2_400bps_fast@v3.5.2_5mCG@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v3.5.2_5mCG@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v3.5.2_5mCG@v2"
  - "dna_r10.4.1_e8.2_260bps_fast@v4.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_260bps_hac@v4.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_260bps_sup@v4.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_260bps_fast@v4.1.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_260bps_hac@v4.1.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_260bps_sup@v4.1.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.1.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.1.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.1.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.2.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.2.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0_5mCG_5hmCG@v3.1"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0_5mC@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0_6mA@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0_6mA@v3"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0_5mC_5hmC@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.3.0_5mC_5hmC@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.3.0_5mC_5hmC@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.3.0_6mA@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.3.0_6mA@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.3.0_6mA@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.3.0_6mA@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.3.0_5mCG_5hmCG@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.3.0_5mCG_5hmCG@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_4mC_5mC@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_4mC_5mC@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_4mC_5mC@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_4mC_5mC@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_5mC_5hmC@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_5mC_5hmC@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_5mC_5hmC@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_5mC_5hmC@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_5mCG_5hmCG@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_5mCG_5hmCG@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_5mCG_5hmCG@v2"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_6mA@v1"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_6mA@v1"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0_6mA@v2"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0_6mA@v2"
  - "rna004_130bps_sup@v3.0.1_m6A_DRACH@v1"
  - "rna004_130bps_hac@v5.0.0_m6A@v1"
  - "rna004_130bps_sup@v5.0.0_m6A@v1"
  - "rna004_130bps_hac@v5.0.0_m6A_DRACH@v1"
  - "rna004_130bps_sup@v5.0.0_m6A_DRACH@v1"
  - "rna004_130bps_hac@v5.0.0_pseU@v1"
  - "rna004_130bps_sup@v5.0.0_pseU@v1"
  - "rna004_130bps_hac@v5.1.0_m5C@v1"
  - "rna004_130bps_sup@v5.1.0_m5C@v1"
  - "rna004_130bps_hac@v5.1.0_inosine_m6A@v1"
  - "rna004_130bps_sup@v5.1.0_inosine_m6A@v1"
  - "rna004_130bps_hac@v5.1.0_m6A_DRACH@v1"
  - "rna004_130bps_sup@v5.1.0_m6A_DRACH@v1"
  - "rna004_130bps_hac@v5.1.0_pseU@v1"
  - "rna004_130bps_sup@v5.1.0_pseU@v1"
stereo models:
  - "dna_r10.4.1_e8.2_4khz_stereo@v1.1"
  - "dna_r10.4.1_e8.2_4khz_stereo@v1.1"
  - "dna_r10.4.1_e8.2_5khz_stereo@v1.1"
  - "dna_r10.4.1_e8.2_5khz_stereo@v1.2"
  - "dna_r10.4.1_e8.2_5khz_stereo@v1.3"
simplex models:
  - "dna_r9.4.1_e8_fast@v3.4"
  - "dna_r9.4.1_e8_hac@v3.3"
  - "dna_r9.4.1_e8_sup@v3.3"
  - "dna_r9.4.1_e8_sup@v3.6"
  - "dna_r10.4.1_e8.2_260bps_fast@v3.5.2"
  - "dna_r10.4.1_e8.2_260bps_hac@v3.5.2"
  - "dna_r10.4.1_e8.2_260bps_sup@v3.5.2"
  - "dna_r10.4.1_e8.2_400bps_fast@v3.5.2"
  - "dna_r10.4.1_e8.2_400bps_hac@v3.5.2"
  - "dna_r10.4.1_e8.2_400bps_sup@v3.5.2"
  - "dna_r10.4.1_e8.2_260bps_fast@v4.0.0"
  - "dna_r10.4.1_e8.2_260bps_hac@v4.0.0"
  - "dna_r10.4.1_e8.2_260bps_sup@v4.0.0"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.0.0"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.0.0"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.0.0"
  - "dna_r10.4.1_e8.2_260bps_fast@v4.1.0"
  - "dna_r10.4.1_e8.2_260bps_hac@v4.1.0"
  - "dna_r10.4.1_e8.2_260bps_sup@v4.1.0"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.1.0"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.1.0"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.1.0"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.2.0"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.2.0"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.2.0"
  - "dna_r10.4.1_e8.2_400bps_fast@v4.3.0"
  - "dna_r10.4.1_e8.2_400bps_hac@v4.3.0"
  - "dna_r10.4.1_e8.2_400bps_sup@v4.3.0"
  - "dna_r10.4.1_e8.2_400bps_fast@v5.0.0"
  - "dna_r10.4.1_e8.2_400bps_hac@v5.0.0"
  - "dna_r10.4.1_e8.2_400bps_sup@v5.0.0"
  - "dna_r10.4.1_e8.2_apk_sup@v5.0.0"
  - "rna002_70bps_fast@v3"
  - "rna002_70bps_hac@v3"
  - "rna004_130bps_fast@v3.0.1"
  - "rna004_130bps_hac@v3.0.1"
  - "rna004_130bps_sup@v3.0.1"
  - "rna004_130bps_fast@v5.0.0"
  - "rna004_130bps_hac@v5.0.0"
  - "rna004_130bps_sup@v5.0.0"
  - "rna004_130bps_fast@v5.1.0"
  - "rna004_130bps_hac@v5.1.0"
  - "rna004_130bps_sup@v5.1.0"

One idea I had - users may not want to use a docker image that includes all models due to it's large size. They may be OK with just downloading the model at runtime and using that to save on docker image download time & storage space.

They take up ~4.2GB:

$ du -sch /dorado_models
4.2G    /dorado_models
4.2G    total

What if we had a nearly identical dockerfile/docker image, but just remove the step to download all the model files? I think that might be useful to someone. Just a thought. We can do that in the future if someone requests it, not necessary to include with this PR.

@fraser-combe
Copy link
Contributor Author

I have updated the relevant files with the required information and removed the lines not needed, thanks for the review!

@kapsakcj
Copy link
Collaborator

Thanks for making those requested changes, Fraser. I made a few small updates to clarify info in the dorado-specific readme.md file and updated some links to match formatting from other links.

I was able to build the docker image locally, which does the cpu only test. It built successfully and tests passed. Here's the command I ran: docker_build -t fraser/dorado:0.8.0-updatedSept30 dorado/0.8.0/

I will test on a local computer with an NVIDIA GPU just to be sure this docker image will work on another machine with a GPU prior to approving/merging/deploying.

@kapsakcj
Copy link
Collaborator

OK I tested running this on a Windows 10 computer with WSL2 using ubuntu 20, with an NVIDIA 3080Ti GPU.

Here's output of nvidia-smi:

$ nvidia-smi
Mon Sep 30 11:34:55 2024
+-----------------------------------------------------------------------------------------+
| NVIDIA-SMI 560.35.02              Driver Version: 560.94         CUDA Version: 12.6     |
|-----------------------------------------+------------------------+----------------------+
| GPU  Name                 Persistence-M | Bus-Id          Disp.A | Volatile Uncorr. ECC |
| Fan  Temp   Perf          Pwr:Usage/Cap |           Memory-Usage | GPU-Util  Compute M. |
|                                         |                        |               MIG M. |
|=========================================+========================+======================|
|   0  NVIDIA GeForce RTX 3080 Ti     On  |   00000000:09:00.0  On |                  N/A |
|  0%   60C    P0            120W /  319W |    1567MiB /  12288MiB |      8%      Default |
|                                         |                        |                  N/A |
+-----------------------------------------+------------------------+----------------------+

+-----------------------------------------------------------------------------------------+
| Processes:                                                                              |
|  GPU   GI   CI        PID   Type   Process name                              GPU Memory |
|        ID   ID                                                               Usage      |
|=========================================================================================|
|    0   N/A  N/A        24      G   /Xwayland                                   N/A      |
|    0   N/A  N/A        35      G   /Xwayland                                   N/A      |
|    0   N/A  N/A        36      G   /Xwayland                                   N/A      |
+-----------------------------------------------------------------------------------------+

Built the image locally with this command which succeeded:

docker buildx build -f dorado/0.8.0/Dockerfile .

Downloaded the test POD5 file with the wget command from the readme, then basecalled using the GPU with this command:

$ docker run --gpus all -v $PWD:/data 4757f5abb7b5 bash -c "dorado basecaller /dorado_models/dna_r10.4.1_e8.2_260bps_sup@v3.5.2 /data/dna_r10.4.1_e8.2_260bps-FLO_PRO114-SQK_NBD114_96_260-4000.pod5 --emit-moves > /data/basecalled.sam"

==========
== CUDA ==
==========

CUDA Version 12.2.0

Container image Copyright (c) 2016-2023, NVIDIA CORPORATION & AFFILIATES. All rights reserved.

This container image and its contents are governed by the NVIDIA Deep Learning Container License.
By pulling and using the container, you accept the terms and conditions of this license:
https://developer.nvidia.com/ngc/nvidia-deep-learning-container-license

A copy of this license is made available in this container at /NGC-DL-CONTAINER-LICENSE for your convenience.

[2024-09-30 15:37:38.493] [info] Running: "basecaller" "/dorado_models/dna_r10.4.1_e8.2_260bps_sup@v3.5.2" "/data/dna_r10.4.1_e8.2_260bps-FLO_PRO114-SQK_NBD114_96_260-4000.pod5" "--emit-moves"
[2024-09-30 15:37:38.620] [info] > Creating basecall pipeline
[2024-09-30 15:37:39.275] [warning] Unable to find chunk benchmarks for GPU "NVIDIA GeForce RTX 3080 Ti", model /dorado_models/dna_r10.4.1_e8.2_260bps_sup@v3.5.2 and chunk size 1440. Full benchmarking will run for this device, which may take some time.
[2024-09-30 15:37:44.437] [info] cuda:0 using chunk size 10000, batch size 320
[2024-09-30 15:37:45.869] [info] cuda:0 using chunk size 5000, batch size 640
[2024-09-30 15:37:48.673] [info] > Simplex reads basecalled: 1
[2024-09-30 15:37:48.673] [info] > Basecalled @ Samples/s: 2.033932e+03
[2024-09-30 15:37:48.673] [info] > Finished

I was monitoring gpu activity with nvtop and saw a spike in GPU activity when running this ✅

Double-checked the SAM file that was produced and it looks good:

# samtools view basecalled.sam
c4b111a0-90eb-436e-b6b1-cf14dee1fb93    4       *       0       0       *       *       0       0       TATGTCTCTGGTTCGGTTGGTCTTGCTAGACACAGGAAGGGGGCCAGGGTGTCAGAGAGCAGAAGATGGGGTGAGGAGTGGTGGGAGCCAGCGTGGAAGGTGTTGACTCTATGGTGACCTGGGTCCCCTCCTGCACCAAGTGGGGTGGCAGTGAGCAGGGTGACTGTCGTCTATGCT $$'(($##"##'+*((((*++,,--.4322236465329**3/BC>====CAAAAAEECDD5))));9;;BFKKIDHF>>>>>GA@BCEDA?999::IGEDDA@54//))))&&&''(((,23(CCDDGEDCEFDBCCABA@@CDDJKOKKHMGEEEFJHGCCABABBBBCDBCCDB    qs:f:14.8748    du:f:0.512      ns:i:2048       ts:i:10 mx:i:1  ch:i:1       st:Z:2023-11-25T19:15:40.684+00:00      rn:i:1  fn:Z:dna_r10.4.1_e8.2_260bps-FLO_PRO114-SQK_NBD114_96_260-4000.pod5     sm:f:920.55  sd:f:179.67     sv:Z:quantile   dx:i:0  RG:Z:test_dna_r10.4.1_e8.2_260bps_sup@v3.5.2    mv:B:c,5,1,0,1,0,0,0,1,1,0,0,1,1,0,0,0,0,0,0,0,1,0,1,0,0,0,1,1,0,0,0,1,0,0,0,0,0,0,0,0,0,0,1,0,1,0,1,0,0,1,1,1,1,0,0,1,1,1,1,0,1,0,1,0,1,0,1,0,1,1,0,0,1,0,0,1,0,1,0,1,0,1,1,1,0,1,0,0,1,0,0,0,0,1,0,1,0,0,0,1,0,0,0,1,0,0,1,1,0,0,1,0,0,0,1,0,1,0,0,0,1,0,1,1,0,0,0,1,1,0,0,0,1,0,1,0,0,1,0,1,0,1,0,1,0,0,0,0,0,1,0,1,0,0,1,0,0,1,1,1,1,0,1,0,0,1,0,0,1,1,0,1,0,1,1,0,0,0,0,1,1,0,0,1,0,0,0,1,0,0,0,0,1,0,1,1,0,1,1,0,1,1,0,1,1,0,1,0,1,1,0,0,1,0,0,0,0,1,1,0,0,0,0,0,1,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,1,0,1,0,1,1,0,1,0,0,1,1,0,0,1,0,1,0,1,0,1,1,0,1,1,1,1,0,1,1,0,1,0,0,1,0,0,0,1,1,0,1,1,1,1,0,1,1,0,1,1,0,1,1,0,0,0,1,0,1,1,0,0,1,0,1,0,0,0,0,1,0,1,1,0,1,0,1,0,1,0,1,0,0,0,1,0,1,0,1,0,1,1,1,1,0,1,0,1,1,0,0,0,1,0,0,1,0,1,0,1,0,1,1,0,1,0,1,0,1,0,1,0,1,1,0,1,0,1,0,1,0,1,1,0,1,0,1,0,0,0,0,0,1,0,1,0,0,0,1,0,1,1,0,1,1,0,1,0,1,0,1,0,1,0

Thanks for your patience with all the requested changes and testing. GPU-enabled software is not super common our collection of containers so I want to ensure it runs smoothly from the start 👍

Copy link
Collaborator

@kapsakcj kapsakcj left a comment

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Approving, knowing that the automated tests failed due to resource limitations and that manual testing in external computing environments succeeded. Will deploy the docker image momentarily to dockerhub and quay using the image name staphb/dorado:latest and staphb/dorado:0.8.0 as well as the versions with quay.io/ prefix

@kapsakcj kapsakcj merged commit 195539a into StaPH-B:master Sep 30, 2024
1 of 2 checks passed
@kapsakcj
Copy link
Collaborator

deploy workflow might fail, but we will see: https://github.com/StaPH-B/docker-builds/actions/runs/11109669669

If it does I can deploy manually to dockerhub and quay

@kapsakcj
Copy link
Collaborator

I deployed the docker image manually. The hard drive is filling up on the github actions runner.

@fraser-combe fraser-combe deleted the dev-dorado branch September 30, 2024 18:31
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment

Labels

None yet

Projects

None yet

Development

Successfully merging this pull request may close these issues.

2 participants