🧬 CRISPR Guide RNA Designer

A fast, user-friendly web app for designing, scoring, and analyzing CRISPR guide RNAs (gRNAs) — no coding required.

---

🚀 Try It Now

• Launch the app on Streamlit
• Free. Open source. No login required.

🧬 CRISPR Guide RNA Designer

A fast, user-friendly web app for designing, scoring, and analyzing CRISPR guide RNAs (gRNAs).

🎬 Demo Video

▶️ Watch on YouTube

🎯 Unique Features

• Zero setup: Paste a DNA sequence or upload a FASTA file
• Multiple PAMs: Cas9 (NGG, NAG) & Cas12a (TTTV) supported
• Hybrid & ML-inspired scoring: Rule-based plus data-inspired consensus
• Off-target scan: Use any DNA as a custom background to spot risk sites
• U6 promoter toggle: One-click “add G at 5’” for U6/T7 promoters
• Indel/protein simulation: Visualize the effect of edits
• AI reporting: One-click Gemini/OpenAI-powered gRNA summaries
• Download results: CSV export for guides and off-targets
• Modern UX: Streamlit-based, works on desktop & mobile
• MIT Licensed: Use, share, fork, or modify

---

👥 Who is this for?

• Molecular, plant, or biomedical researchers
• Academic labs and classroom use
• Biotech & R&D teams (fast pilot CRISPR projects)
• Students, DIY bio, and open-science community

---

🛠️ How to Use

1. Open the app (see link above)
2. Paste DNA or upload FASTA
3. Select PAM/parameters in the sidebar
4. (Optional) Toggle U6 Promoter for gRNA with 5' G
5. Click Find gRNAs
6. Review and download results
7. (Optional) Paste background DNA to scan off-targets
8. (Optional) Run indel/protein simulation or AI-powered report

---

📊 Scoring Methodology

Hybrid Score: Based on established lab rules (GC content, homopolymers, seed region, off-target penalty, terminal base).
ML-inspired Score: Derived from features found in ML studies of gRNA efficacy (but not a trained ML model).
Consensus Score: Balanced average of the two for ranking.

Note: Scores help prioritize guides, but do not replace experimental validation.

---

📝 Installation (For Local Use)

git clone https://github.com/Dinesh431786/Crispr.git
cd crispr/crispr_app
pip install -r requirements.txt
streamlit run app.py

🔑 AI API Keys
Gemini (Google): Get API key

OpenAI: Get API key

Paste your key in the app sidebar for AI-powered explanations.

🧪 Example FASTA
fasta
Copy
Edit
>TestGene
ATGAGTCTGCTCTTCGCGTTGGAGTGAAATCTGAGATGATGGGTTGAAATCGCAGTTCGACCTGAACTTTTATCTGCTCTTCGCGTTGAGCGGACCGTGGGAAGTTTCGCGTTGATCAGTTCTTCTGCTCTTCGCGTTTAAGCCTTGCGTTGTTTATCTGCTCTTCGCGTTTATCAGCCTGGGCGTTGATCTTTTATCTGCTCTTCGCGTTAACGGAAGCCGG
🙋 FAQ
Is it free?
Yes, open source and free for all.

Does it use real ML?
No, scoring is based on published ML findings but is rule-based.

Species?
Works for any DNA (human, plant, animal, microbe, synthetic).

AI required?
All core features work without AI. AI summary is optional with API key.

🤝 Contributing
Pull requests, feedback, and bug reports welcome!
See CONTRIBUTING.md for details.

👨‍🔬 Author
Dinesh K — design, code, and documentation
GitHub

⚖️ License
MIT License — free for all use.