Coordination discrepancy in output CSV

[justdx]

Firstly, I would like to express my gratitude for the development of TRASH. It has proven to be a valuable tool for annotating centromeres. However, upon reviewing my running results, I noticed an issue in the output CSV file. The coordinate positions of the repeat did not align with the sequence; there was a one-base shift to the right.

Additionally, when annotating HOR, I encountered an unexpected problem. During the first run, despite specifying the parameter "--horclass" and providing the corresponding CSV file, an error consistently occurred, indicating that the alignment file could not be found. Consequently, I had to execute the tool a second time, this time using the parameter "--horonly". I am uncertain about the cause of this issue and would appreciate any insights you can provide.

[junhaiqi]

Hello，I don't understand how to identify HOR by TRASH. Can you give a command line example? Thank you very much!

[justdx]

Here are the scripts that I used to run TRASH. It is suggested to set thread (--par) as the number of chromosomes:
/TRASH/TRASH_run.sh assembly.fa --seqt CEN178.csv --horclass CEN178 --par 5 --o ./
/TRASH/TRASH_run.sh assembly.fa --seqt CEN178.csv --horclass CEN178 --par 5 --horonly --o ./

and below is content of "CEN178.csv":
name,length,seq
CEN178,178,AGTATAAGAACTTAAACCGCAACCGATCTTAAAAGCCTAAGTAGTGTTTCCTTGTTAGAAGACACAAAGCCAAAGACTCATATGGACTTTGGCTACACCATGAAAGCTTTGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTCGAATATGACTTGATGTCATGTGTATGATTG

[junhaiqi]

I see，thank you very much!