Invalid Taxid while Mapping

[arpit20328]

12:31:27.687 [INFO] deciding the existence of a reference:
12:31:27.687 [INFO] preset profiling mode: 3
12:31:27.687 [INFO] minimum number of reads per reference chunk: 50
12:31:27.687 [INFO] minimum number of uniquely matched reads: 20
12:31:27.687 [INFO] minimum proportion of matched reference chunks: 0.800000
12:31:27.687 [INFO] maximum standard deviation of relative depths of all chunks: 2.000000
12:31:27.687 [INFO]
12:31:27.687 [INFO] minimum number of high-confidence uniquely matched reads: 5
12:31:27.687 [INFO] minimum query coverage of high-confidence uniquely matched reads: 0.750000
12:31:27.687 [INFO] minimum proportion of high-confidence uniquely matched reads: 0.100000
12:31:27.687 [INFO]
12:31:27.687 [INFO] taxonomy data:
12:31:27.687 [INFO] taxdump directory: /home/arpit/clark/CLARKV1.3.0.0/DIR_DB/taxonomy
12:31:27.687 [INFO] mapping reference IDs to TaxIds: [cut_1_3_nucl_gb_accession2taxid]
12:31:27.687 [INFO]
12:31:27.687 [INFO] reporting:
12:31:27.687 [INFO] default format : outfile
12:31:27.687 [INFO] -------------------- [main parameters] --------------------
12:31:27.687 [INFO]
12:31:27.687 [INFO] stage 1/4: counting matches and unique matches for filtering out low-confidence references
12:31:27.687 [INFO] parsing file: search.kmcp@db1.kmcp.tsv.gz
12:31:27.724 [ERRO] unknown taxid for NEW_KRAKEN_DATABASE, please check taxid mapping file(s)
(

[arpit20328]

I have ref fasta file as:

NZ_CP014581.1
AGCCGGTCGCCAACTTCAGCTCTCGTACATCCGGAGTCCAGCAGCGAGACGATCAGCTCC
TGATCCGTTGTTATGACGCCGTCCGATTCACACTTTCGCATGCGAAATTTTACTCACTGT
TCGACCGTACTGTAATTTTGTACGGAGTGCGCGCAGCGGCGCAGATATGAAAGACCTTCC
GACTGCAGCAGTCCTGTCCATCCGGACCAGAAGGGCCGTCGTTCCCGCTCGACTCTACTT
GACCAAGCCGGGCCTGACTCGCGGCGTCAGCAGCCACGAAACCTCGCCTTTCGGGCACTT
CGAACGCACTCAAACACGAGCGATTCTAGCCGAACCACGTAGCCCGATCCAGGGGGATAT
CGGACTTATTTCGCACCATCTATTGACCGTCAACATTTCTAATAATAATATCCGTTGCAC
GTGACCACACGTCACCCATCAAAAATCAATGGACCGTCAATAACCGGAGCGTCTCATGTC
CAACACCGTGCAATCGCGCATCTACCAGGCCCTTACCGAACTGATTCCGAATCTTGGAAA

My taxid file is like

A00001.1 10641
A00002.1 9913
A00003.1 9913
A00004.1 32630
A00005.1 32630
A00006.1 32630
A00008.1 32630
A00009.1 32630
A00010.1 32630
A00011.1 32630

what is the problem exactly ? should header of fasta be of taxid and not accession number ?

[arpit20328]

Do the taxid file can't contain any other taxid which is not present in the reference.fasta ?

[shenwei356]

The file is for mapping references IDs, not sequence IDs, to TaxIds. cut_1_3_nucl_gb_accession2taxid should be a file mapping sequence accession to taxids.

unknown taxid for NEW_KRAKEN_DATABASE, please check taxid mapping file(s)

I worry about the index now. This means there's a reference genome named NEW_KRAKEN_DATABASE.

[arpit20328]

@shenwei356 Can you provide kmcp indexed file and its database (.fna) file for bacterial identification ? my data is paried end cell free DNA fastq data.

[shenwei356]

As mentioned here, there's one: https://1drv.ms/f/s!Ag89cZ8NYcqtlgAtJo--uKPNVT4t?e=KEDFrc

You can also try other tools, like motus3 and metaphyan4 and sylph, if you just need bacterial identification.

[arpit20328]

So I have to download

along with taxdump files as follows ?

and the taxid file as follows ?

[shenwei356]

The choice of taxdump file and taxid file depends on you.

• The default ones are for NCBI taxonomy data.
• Those in your pasted pictures are a mix of GTDB and NCBI taxonomy data. more info: https://bioinf.shenwei.me/kmcp/database/#merging-gtdb-and-ncbi-taxonomy

[ayoraind]

@shenwei356, I have a similar problem. I created a custom taxdump file of my reference fasta files (Illumina MiSeq). I followed the steps in the Github page to create kmers from my mock metagenome dataset (derived from two or three of my reference strains) and indexed these kmers. My goal is to estimate the relative abundance of the reference strains in the metagenome (Nanopore). However, I am stuck at this error after running the kmcp profile command.
Here is the command

kmcp profile --taxid-map taxdump-custom_strain/taxid.map --taxdump taxdump-custom_strain/ search.kmcp@dbforERRXXX.kmcp.tsv.gz

The error message is

13:51:39.536 [INFO] stage 1/4: counting matches and unique matches for filtering out low-confidence references
13:51:39.536 [INFO]   parsing file: search.kmcp@dbforERRXXX.kmcp.tsv.gz
13:51:39.537 [ERRO] unknown taxid for Eco01234-190003_contigs_filtered, please check taxid mapping file(s)

However, the taxid.map file contains all information on the reference, including the taxid generated previously

echo 7579494 | taxonkit lineage --data-dir taxdump-custom_strain/

# this returns
7579494	"24" "Eco01234-190003_contigs_filtered" "Bacteria" "Proteobacteria" "Gammaproteobacteria" "Enterobacterales" "Enterobacteriaceae" "Escherichia" "Escherichia coli" "Eco01234-190003_contigs_filtered"

What am I doing wrong?