Fixed help variable

Author: olabiyi

Amplicon/Illumina/Workflow_Documentation/SW_AmpIllumina-B/workflow_code/main.nf

@@ -7,6 +7,7 @@ c_bright_green = "\u001b[32;1m";
 c_blue = "\033[0;34m";
 c_reset = "\033[0m";
 
+params.help = false
 /**************************************************
 * HELP MENU  **************************************
 **************************************************/

Amplicon/Illumina/Workflow_Documentation/SW_AmpIllumina-B/workflow_code/nextflow.config

@@ -14,7 +14,7 @@ params {
     enable_visualizations = false
     // a 4-column file with these exact headers [ Sample Name, read1_path, raw_R1_suffix, groups]
     // without the brackets, quotations and commas ofcourse.
-    runsheet  = "${baseDir}/test_runsheet.csv"    
+    runsheet  = ""    
 
     // -------- End of Mandatory if not using GLDS_accession ----------------//
 

Amplicon/Illumina/Workflow_Documentation/SW_AmpIllumina-B/workflow_code/slurm_submit.slurm

@@ -0,0 +1,63 @@
+#!/bin/bash
+
+#SBATCH --job-name="nf_master" ## Replace job_name with the name of the job you are running ##
+#SBATCH --output=nf_master.o.%j ## Replace job_name with the name of the job you are running ##
+#SBATCH --error=nf_master.e.%j ## Replace job_name with the name of the job you are running ##
+#SBATCH --partition=normal ## Specifies the job queue to use, for urgent jobs change normal to priority ##
+#SBATCH --mem=2G ## Memory required to run the job in MB, this example is showing 10,000 MB or 10GB, change this number based on how much RAM you need ##
+#SBATCH --cpus-per-task=1 ## Number of CPUs to run the job, this example is showing 5 CPUs, change this number based on how many CPUs you need ##
+#SBATCH --mail-user=email@domain.com ## Specifies the e-mail address to e-mail when the job is complete, replace this e-mail address with your NASA e-mail address ##
+#SBATCH --mail-type=END ## Tells slurm to e-mail the address above when the job has completed ##
+
+. ~/.profile
+
+
+echo "nf_master" ## Replace job_name with the name of the job you are running ##
+echo ""
+
+
+## Add a time-stamp at the start of the job ##
+start=$(date +%s)
+echo "start time: $start"
+
+## Print the name of the compute node executing the job ##
+echo $HOSTNAME
+
+
+## Activate the conda environemnt containing the tools you need to run your job ##
+## You can see a list of all available environments by running the command: conda env list ##
+## If you need a conda envrionment installed request it using JIRA ##
+
+source activate /path/to/envs/nextflow ## Replace conda_env_name with the name of the environment ##
+
+
+## Print the version of the tool you are using to ensure the tool version is recorded ##
+echo ""
+echo "Nextflow version: " ## Replace Tool with the name of the tool you are using ##
+nextflow -v ## Replace this command with the command the tool uses to print its version ##
+echo ""
+
+
+## The command(s) that you want to run in this slurm job ##
+export NXF_SINGULARITY_CACHEDIR=singularity/
+nextflow run main.nf -resume -profile slurm_sing --GLDS_accession GLDS-487 --target_region 16S --F_primer AGAGTTTGATCCTGGCTCAG --R_primer CTGCCTCCCGTAGGAGT  ## Replace command with the command(s) you want to run ##
+
+
+## Add a time-stamp at the end of the job then calculate how long the job took to run in seconds, minutes, and hours ##
+echo ""
+end=$(date +%s)
+echo "end time: $end"
+runtime_s=$(echo $(( end - start )))
+echo "total run time(s): $runtime_s"
+sec_per_min=60
+sec_per_hr=3600
+runtime_m=$(echo "scale=2; $runtime_s / $sec_per_min;" | bc)
+echo "total run time(m): $runtime_m"
+runtime_h=$(echo "scale=2; $runtime_s / $sec_per_hr;" | bc)
+echo "total run time(h): $runtime_h"
+echo ""
+
+
+## Print the slurm job ID so you have it recorded and can view slurm job statistics if needed ##
+echo "slurm job ID: ${SLURM_JOB_ID}"
+