generic amplicon with umi in non-model species

[aitor98al]

I'm trying to analyze my data with MIXCR. I'm working with O.Mykiss (rainbow_trout) and the preset named generic-amplicon-with-umi. The UMI codes are in R1 and the sample barcode in R2. This are my UMI codes and sample barcodes:
-UMI: tNNNNtNNNNtNNNNtcttgggg
-S1 IgM: CGGAGATATGATGACTCTGG
-S2 IgT: GGAACCCCTTCTAACGACAT
How should I use the preset for obtaining my secuences demultiplexed and with the UMI extracted?

Thanks in advanced.

[mizraelson]

Hi,
So first of all you would need a reference library. You can use the IMGT one or build your own reference. Also, What is the structure of your sample barcodes in R2? Do you mean you just have different Isotypes or are those actually different samples?

[aitor98al]

Hi, I have already my custom reference library.
The structure of the sample barcode are those I wrote above and they are different Isotypes. My question is how to write the tag pattern to demultiplex.

[mizraelson]

So you want isotypes to be processed as different samples? Usually we do not de-multiplex the data by isotypes because technically its the same sample.
If needed you can do:

--tag-pattern '^(UMI:N{16})N{7}(R1:*) \ ^(R2:(SMPL:N{20})*)'

And then you can also add sample names for each isotype primer using --sample-sheet file.tsv:

Sample	TagPattern	SMPL
S1-IgM		CGGAGATATGATGACTCTGG
S1-IgT		GGAACCCCTTCTAACGACAT