Aligning sanger sequencing traces to plasmids across the origin

[manulera]

Hello! I have been looking for a tool to align sanger sequencing traces to plasmids. Unlike for genomic regions, the sequencing trace may traverse the origin (coordinate zero). Dummy example below, where sequencing trace is GCGTTGCGCTCAAAG

plasmid            AAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTC
sequencing trace   AAAG                                             GCGTTGCGCTC

I am thinking of using a combination of clustalomega + MARS (https://github.com/lorrainea/MARS) that does the trick, but I was wondering if there is something in tracy that could be used for this.

[tobiasrausch]

I am afraid no. Tracy aligns to a linear reference. Maybe one could add the beginning of the plasmid also to the end to account for traces going over the origin? I am not sure, maybe this has other issues - you probably tried this already?

[manulera]

Yes, I thought of using the same sequence twice as you suggest , but I am not familiar with aligning algorithms so I thought it may mess up the result.