3.8.1

What's Changed

• clicking on sequence of circular viewer scrolls the linear viewer by @bugzpodder in #208
• keyboard presses are fixed -- eg clicking up/down/right/left moves the sequence cursor to that sequence by @bugzpodder in #209

Full Changelog: 3.8.0...3.8.1

3.8.0

What's Changed

• add custom children support by @bugzpodder in #206

Custom Rendering
This makes use of the children and refs props to allow custom rendering of the sequence viewers. For example, to render the linear viewer above the circular viewer:

import { useRef } from "react";
import { SeqViz, Linear, Circular } from "seqviz";

export default () => {
  const linearRef = useRef();
  const circularRef = useRef();

  return (
    <SeqViz
      name="J23100"
      seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC"
      refs={{circular: circularRef, linear: linearRef}}
    >
      {({ circularProps, linearProps, ...props }) => (
        <div
          style={{ display: "flex", flexDirection: "column", width: "100%" }}
        >
          <div ref={linearRef} style={{ height: "25%", width: "100%" }}>
            <Linear {...linearProps} {...props} />
          </div>
          <div ref={circularRef} style={{ height: "75%", width: "100%" }}>
            <Circular {...circularProps} {...props} />
          </div>
        </div>
      )}
    </SeqViz>
  );
};

• Bump yaml from 1.10.2 to by @dependabot in #204

New Contributors

• @bugzpodder made their first contribution in #206

Full Changelog: 3.7.13...3.8.0

3.7.13

Full Changelog: 3.7.12...3.7.13

• fix passing of compSeq to override default: #203

3.7.12

Full Changelog: 3.7.11...3.7.12

• fix not rendering AA sequences: #202

3.7.11

What's Changed

• Bump webpack from 5.74.0 to 5.76.0 by @dependabot in #200
• Bump webpack from 5.74.0 to 5.76.0 in /demo by @dependabot in #199
• Fixes annotation sort ordering inconsistency: #201

Full Changelog: 3.7.10...3.7.11

3.7.10

Full Changelog: 3.7.9...3.7.10

Fix InfiniteScroller ref checks: #197

3.7.9

What's Changed

• Parse/render files synchronously by @jjtimmons in #196

Note: this may break SnapGene file rendering/parsing -- because it's async. Please @ me if that's an issue. You can fix by using seqparse externally to the library. But I can also add some special "is this a SnapGene file prop" behavior

Full Changelog: 3.7.8...3.7.9

3.7.8

Full Changelog: 3.7.7...3.7.8

Fixes sequence text height on Safari: #193

3.7.7

Full Changelog: 3.7.6...3.7.7

Fix removal of enzymes re: #195

3.7.6

Full Changelog: 3.7.5...3.7.6

• Darken the highlighted region of enzyme cut sites (instead of changing its width)